Learning Exercise

The Polymerase Chain Reaction in the Diagnosis of Disease

Students learn the principles of pcr through animations and explanations at the website.They apply their knowledge to a written worksheet that includes questions about pcr as a diagnostic tool.
Course: Introductory classes in biology of infectious diseases
Share

Discussion and illustrations/animations of the polymerase chain reaction. see more

Exercise

Please review the materials at the website and complete the following worksheet.

Each of the DNA sequences below was derived from a different bacterium A - E.

A
5'AATCGGTCATACGTGCCTGA3'

3'TTAGCCAGTATGCACGGACA5'
B
5'TGAATGCTGACCCTGAATGC3'

3'ACTTACGACTGGGACTTACG5'
C
5'ATTGGTGGAACTTATGTACT3'

3'TAACCACCTTGAATACATGA5'
D
5'GCATACGTACGGTTCCAATG3'

3'CGTATGCATGCCAAGGTTAC5'
E
5'CTTATGTACTTGAATGCTGA3'

3'GAATACATGAACTTACGACT5'

1. What four nucleotide primers would allow replication of the complete DNA
sequence from both strands of bacterium A?

2. To which of the bacteria would each of the following probes bind? To which
strand?
a. 5'AATC3'
b. 5'CTAA3'
c. 5'CTTA3'
d. 5'ATGC3'

3. Design a four-nucleotide probe that will recognize only bacterium E.

4. What is the difference between a probe and a primer?

5. Explain how pcr can be used to identify a pathogen within a specimen from a
patient. Why does pcr have such high sensitivity and specificity as a diagnostic
tool?

Technical Notes

Student must download the animation. If the instructor plays the animation during class, it may not be necessary for all students to view it again.

Requirements

Some knowledge of DNA structure and replication.
Introduction to concepts of sensitivity and specificity.

Topics

polymerase chain reaction
diagnosis of infectious disease

Learning Objectives

To explain the theory and science behind the polymerase chain reaction.
To describe the process of pcr.
To discuss the advantages and disadvantages of pcr as a diagnostic tool.