Course: Genetics, Intro Biology"/>
Search all MERLOT
Select to go to your profile
Select to go to your workspace
Select to go to your Dashboard Report
Select to go to your Content Builder
Select to log out
Search Terms
Enter username
Enter password
Please give at least one keyword of at least three characters for the search to work with. The more keywords you give, the better the search will work for you.
select OK to launch help window
cancel help

MERLOT II




        

Search > Learning Exercise Results > Cracking the Genetic Code

Learning Exercise: Cracking the Genetic Code

Title:
Cracking the Genetic Code
Material:
Description:
Students use the TranslationLab to determine the genetic code by translating di-, tri-,and tetra-nucleotide repeats.
Course: Genetics, Intro Biology

Info

Submitted by:
Jeff Bell
Date Last Modified:
September 04, 2000

Exercise

Cracking the Genetic Code









X-SAS-UseImageHeight ALIGN=bottom>


Cracking the Code



During the late 1950s and early 1960s researchers were
able to solve one of the major secrets of life, how genes
worked. The problem the researchers were trying to solve was
how a linear sequence of four nucleotides (A, G, C, and U)
in RNA determined the amino acid sequence of proteins made
up of twenty different amino acids. The simulation,
TARGET="_blank">TranslationLab will allow you to
reproduce some of the experiments that the scientists used
to figure out how this was accomplished. Your mission,
should you choose to accept it, is to crack the genetic code
of life. Be sure to read the introduction in the lab manual
or the
introduction
at the site before you begin. The purpose of this laboratory
is to:




  • Study the relationship between the nucleotide
    sequence of a mRNA molecule and protein synthesis.

  • Simulate pioneering experiments that were used to
    delineate the genetic code.

  • Demonstrate how a mutation in the nucleotide sequence
    of a mRNA molecule results in a change in the amino acid
    sequence of aprotein.


You need to use careful logic to figure out the answers
to the following question and you must show your reasoning.
You may work in pairs to figure these out but be sure you
understand the logic you use to solve these problems. This
assignment is worth twenty points and is due the week of
April 17th in your discussion section.



1. As having each nucleotide code for one amino acid
would only allow for four different amino acids per protein,
it was obvious to the researchers that there had to be some
conversion between multiple bases and each amino acid. Would
two nucleotides at a time be sufficient to provide enough
different combinations (called codons) to code for all
twenty amino acids? Why or why not? Will three nucleotides
per codon work? Why or Why not?



2. A major step forward in figuring out the code was the
discovery by Nirenberg in 1961 that a cell free extract made
from E. coli cells could translate RNA added to the extract
into proteins. The newly synthesized proteins composition
could be determined by measuring the incorporation of
radioactive amino acids. In his first experiment he made
poly-U RNA, using the enzyme polynucleotide synthetase, and
translated it into poly-phenylalanine using the cell-free
extract. This was definitive proof that RNA could code for
the synthesis of proteins and gave the first possible
assignment of a nucleotide code to the amino acid it
specified. Using TranslateIt, what does poly-U code for?
What do the other three bases each code for?



3. While the Nirenberg experiments showed that RNA did
determine the amino acids in the protein, they did not showhow many bases were used for each codon, whether the codes
were overlapping (is the second codon read from the second
base [overlapping] or from the first base after the last
base of the first codon [no overlap]), or whether there
could be bases in-between the codons that did not code for
anything (AUCGGGCAACGGGACAGGGGG, for instance, where the G's
in between AUC, AAC and ACA aren't translated into amino
acids - just like we use spaces to separate words in a
sentence). Khorana developed a means to produce
poly-dinucleotide and, later, poly-trinucleotide and
poly-tetranucleotide sequences of DNA that could then be
transcribed into RNA. These artificial RNA templates were
translated in the cell free translation mix. If the code is
read two bases at a time what result would you expect for a
poly-dinucleotide such as ACACACAC? Try it and see whether
your prediction was correct. From your results can you say
whether the code is even or odd? Will you get a different
result with CACACA than you did with ACACACAC? This result
shows that in these crude extracts translation starts at a
random location in the RNA sequence.



4. From what you've already discovered, what do you think
will happen if you use a poly-trinucleotide such as AAC? Try
it. Did you get the result you expected? Explain what
happened. Will ACA or CAA give a different result? From
these results can you now tell how many bases there are in a
codon? If so, how many are there and how do you know this?
Comparing this result to the result from the
poly-dinucleotide AC can you now specify a codon for one of
the amino acids incorporated by these templates? If so,
which codon and amino acid go together? Byelimination, can
you assign another codon-amino acid pair? [hint: using what
you know now look back at the dinucleotide experiment with
AC] What is it? Try CAC next. Did the results support your
codon assignment? Is there evidence here that one of the
amino acids must have more than one codon that codes for it?
If so, which one?



5. What do you think will happen if you translate a
tetranucleotide? Try translating the tetranucleotide CAAG.
Did you get the result you expected? Can you now assign a
codon to any of the other amino acids that appeared in
problem 4 above? [Don't worry about any new amino acids that
showed up here, just solve the codons for the amino acids in
problem 4] If so, what are they? Test your assignment with
AACG. Did this confirm your results? Using the above data
and any other experiments that are necessary, assign amino
acids to all possible codons that do not include G or U,
only various combinations of A and C.



6. Now try AU, AAU and AUU. Did you notice something
different this time? What happened and how would you explain
this unusual result? List any new codon assignments that you
were able to make from these experiments. Use
tetranucleotides to figure out the amino acids that go with
the correct assignments for the codons that can be produced
using only A and U. What unusual result did you see with
some of the tetranucleotides and what is your explanation
for this result?



7. Now try GGG, GGA, GGC, and GGU. What amino acid showed
up in all four experiments? Are there any codons in common
between these four reactions? If not, then what must be true
to explain your results? Can you propose a codon or codons
for the amino acid that showed up in all four experiments?
Is there anything in common between the codons that you've
just assigned to this amino acid? What is it? Use
tetranucleotides to prove that your assignment is correct.
Comparing these results to the ones above, can you say
whether some positions in the codon are less important than
others in specifying which amino acid is coded for?

Audience

  • College General Ed

Topics

Translation, the Genetic code

Learning Objectives

Study the relationship between the nucleotide sequence of a mRNA molecule and protein synthesis.
Simulate pioneering experiments that were used to delineate the genetic code.
Demonstrate how a mutation in the nucleotide sequence of a mRNA molecule results in a change in the amino acid sequence of a protein.

Type of Task

  • Core activity
  • Student-centered
  • Team
  • Unsupervised




        
Go to MERLOT's page on Facebook
Go to MERLOT's page on Twitter
Go to MERLOT's page on LinkedIn
Go to MERLOT's RSS Feeds
Go to MERLOT's blog on Wordpress
Go to MERLOT's YouTube Page
Get MERLOT's Android App
Get MERLOT's iPhone/iPad App
MERLOT policies and practices